It is currently Mon Jun 17, 2019 9:30 am



Reply to topic  [ 1 post ] 
FAQ: Considering gaps when calculating consensus of an MSA. 
Author Message

Joined: Tue Feb 08, 2011 8:23 pm
Posts: 19
Post FAQ: Considering gaps when calculating consensus of an MSA.
When calculating the consensus of a multiple sequence alignment, gaps are ignored by default. For example, in an alignment of three sequences where two sequences contain a gap at a particular position, then the third sequence is classed as having 100% identity to the consensus position which is based on the sequence without the gap.
e.g.

Code:
seq1 cgttgctaggatc--agcg tatt-ccttaggctag
seq2 cgragcta---tgctag---attcggctta---tag
seq3 cttcgcta---ttctag---attcggctta---tag
con  cgtgctaggat ctagcgtattcgggcttaggctag


Note that wherever there is a gap, then the consensus uses the other sequences, unless the "Treat gaps as valid characters" option is selected.

Ensuring gaps are considered when calculating the consensus of a multiple alignment.

Use the "Treat gaps as valid characters" option to ensure that gaps are considered in the calculation of the consensus sequence. This option can be enabled as follows:


1. Select Analyze | ClustalW Alignment to open the Alignment Views dialog.

2. Select the Set Options button to open the Multiple Alignment Options dialog.

3. Click on the Consensus tab to display the Treat gaps as valid characters option.

4. Select the tickbox next to the option to enable it.

Removing gaps from the consensus of a multiple alignment

Use the No gaps in consensus option in conjunction with the Treat gaps as valid characters option to exclude gaps from the consensus. This option is enabled as follows:


1. Select Analyze | ClustalW Alignment to display the Alignment Views dialogue.

2. Click the Set Options button to display the Multiple Alignment Options dialog.

3. Click on the Consensus tab to display the No gaps in consensus option. Select the tickbox next to this option.


Tue Feb 08, 2011 8:54 pm
Profile
Display posts from previous:  Sort by  
Reply to topic   [ 1 post ] 

Who is online

Users browsing this forum: No registered users and 2 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Jump to:  
cron
Powered by phpBB © 2000, 2002, 2005, 2007 phpBB Group.
Designed by ST Software for PTF.