Home MacVector Assembler Downloads Try HowToBuy Support Contact Forums

MacVector Forums

MacVector, Inc maintains a series of forums where you can discuss MacVector-related issues with our staff and other users.

Go to the forums...

For tutorials and other downloads, please go to Downloads page.

To communicate with a live human body knowledgable in all technical aspects of MacVector and Assembler, please call or email:

US and worldwide (except Europe)

support@macvector.com

(919) 303-7450

(866) 338-0222

Europe

support@macvector.com

+44 (0) 1223 410 552

Support Home

Click here to get back to the main support page.

Considering gaps when calculating the consensus of a multiple alignment

When calculating the consensus of a multiple sequence alignment, gaps are ignored by default. For example, in an alignment of three sequences where two sequences contain a gap at a particular position, then the third sequence is classed as having 100% identity to the consensus position which is based on the sequence without the gap.
e.g.

seq1 cgttgctaggatc--agcgtatt—ccttaggctag

seq2 cgtagcta---tgctag---attcggctta---tag

seq3 cgtcgcta---ttctag---attcggctta---tag

con  cgt gctaggat ctagcgtattcggcttaggctag


Note that wherever there is a gap, then the consensus uses the other sequences, unless the "Treat gaps as valid characters" option is selected.

Ensuring gaps are considered when calculating the consensus of a multiple alignment.

Use the "Treat gaps as valid characters" option to ensure that gaps are considered in the calculation of the consensus sequence. This option can be enabled as follows:


1. Select Analyze | ClustalW Alignment to open the Alignment Views dialog.

2. Select the Set Options button to open the Multiple Alignment Options dialog.

3. Click on the Consensus tab to display the Treat gaps as valid characters option.

4. Select the tickbox next to the option to enable it.

 

Removing gaps from the consensus of a multiple alignment

Use the No gaps in consensus option in conjunction with the Treat gaps as valid characters option to exclude gaps from the consensus. This option is enabled as follows:


1. Select Analyze | ClustalW Alignment to display the Alignment Views dialogue.

2. Click the Set Options button to display the Multiple Alignment Options dialog.

3. Click on the Consensus tab to display the No gaps in consensus option. Select the tickbox next to this option.

Copyright © 2012 MacVector, Inc. All rights reserved. Terms of Use.

MacVector, Inc • PMB 150 • 1939 High House Road • Cary • North Carolina 27519 • USA

phone: +1-919-303-7450 • toll free: +1-866-338-0222 • fax: +1-919-303-7449

MacVectorInc202px